Transcript: Mouse NM_144548.1

Mus musculus interleukin 23 receptor (Il23r), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Il23r (209590)
Length:
2488
CDS:
76..2055

Additional Resources:

NCBI RefSeq record:
NM_144548.1
NBCI Gene record:
Il23r (209590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089494 CGGAGGAATCACAAGTATAAA pLKO.1 186 CDS 100% 15.000 10.500 N Il23r n/a
2 TRCN0000089496 CCTACATAGATACCAAGTATA pLKO.1 575 CDS 100% 13.200 9.240 N Il23r n/a
3 TRCN0000089497 CCACAGATTACAAAGAAGAAA pLKO.1 1517 CDS 100% 5.625 3.938 N Il23r n/a
4 TRCN0000089495 CCCACAGATTACAAAGAAGAA pLKO.1 1516 CDS 100% 4.950 3.465 N Il23r n/a
5 TRCN0000089493 GCTGTGCTTGTTTGCTTGTTT pLKO.1 2197 3UTR 100% 5.625 3.375 N Il23r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.