Transcript: Human NM_144601.4

Homo sapiens CKLF like MARVEL transmembrane domain containing 3 (CMTM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CMTM3 (123920)
Length:
2439
CDS:
636..1184

Additional Resources:

NCBI RefSeq record:
NM_144601.4
NBCI Gene record:
CMTM3 (123920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116917 GCTTCTTAACAGATGGCATTT pLKO.1 2145 3UTR 100% 10.800 8.640 N CMTM3 n/a
2 TRCN0000299211 GCTTCTTAACAGATGGCATTT pLKO_005 2145 3UTR 100% 10.800 8.640 N CMTM3 n/a
3 TRCN0000116921 CGGCCCTCATCTACTTTGCTA pLKO.1 961 CDS 100% 3.000 2.400 N CMTM3 n/a
4 TRCN0000299213 CGGCCCTCATCTACTTTGCTA pLKO_005 961 CDS 100% 3.000 2.400 N CMTM3 n/a
5 TRCN0000116920 CATCGTGTTTGCAACTGATTT pLKO.1 1055 CDS 100% 13.200 9.240 N CMTM3 n/a
6 TRCN0000116918 CCATCGTGTTTGCAACTGATT pLKO.1 1054 CDS 100% 4.950 3.465 N CMTM3 n/a
7 TRCN0000299162 CCATCGTGTTTGCAACTGATT pLKO_005 1054 CDS 100% 4.950 3.465 N CMTM3 n/a
8 TRCN0000116919 CGGGTCTCTCATTCATCACTT pLKO.1 781 CDS 100% 4.950 3.465 N CMTM3 n/a
9 TRCN0000299212 CGGGTCTCTCATTCATCACTT pLKO_005 781 CDS 100% 4.950 3.465 N CMTM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144601.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.