Transcript: Human NM_144639.3

Homo sapiens urocanate hydratase 1 (UROC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
UROC1 (131669)
Length:
3264
CDS:
55..2085

Additional Resources:

NCBI RefSeq record:
NM_144639.3
NBCI Gene record:
UROC1 (131669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423464 TTAGGGAGACCTCCAACATTT pLKO_005 1718 CDS 100% 13.200 18.480 N UROC1 n/a
2 TRCN0000156776 GCAACTGTACGGACACATCTA pLKO.1 258 CDS 100% 4.950 6.930 N UROC1 n/a
3 TRCN0000152853 GACCATGTTCTACTTGTCGAA pLKO.1 474 CDS 100% 2.640 3.696 N UROC1 n/a
4 TRCN0000153968 CGCCATCATGCACATGATTAT pLKO.1 357 CDS 100% 1.320 1.848 N UROC1 n/a
5 TRCN0000152373 CATGTTCTACTTGTCGAAGAT pLKO.1 477 CDS 100% 4.950 3.960 N UROC1 n/a
6 TRCN0000158102 CCGCCATCATGCACATGATTA pLKO.1 356 CDS 100% 1.320 1.056 N UROC1 n/a
7 TRCN0000152639 GACATATTCTCCCAGGGATTT pLKO.1 1372 CDS 100% 10.800 7.560 N UROC1 n/a
8 TRCN0000446742 TCTTCTGGGACTACGGCAATG pLKO_005 1250 CDS 100% 6.000 4.200 N UROC1 n/a
9 TRCN0000157229 GAAGGAGGATAGACCAGGAAA pLKO.1 2539 3UTR 100% 4.950 3.465 N UROC1 n/a
10 TRCN0000157781 CTGGTGACCTATGGAGGAAAT pLKO.1 418 CDS 100% 10.800 6.480 N UROC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144639.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.