Transcript: Human NM_144722.4

Homo sapiens sperm flagellar 2 (SPEF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SPEF2 (79925)
Length:
3008
CDS:
136..1680

Additional Resources:

NCBI RefSeq record:
NM_144722.4
NBCI Gene record:
SPEF2 (79925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151174 GACTTGCTAGATACCAATGAT pLKO.1 1624 CDS 100% 5.625 7.875 N SPEF2 n/a
2 TRCN0000152032 CGGATTACATACAGGTTTCAA pLKO.1 595 CDS 100% 5.625 4.500 N SPEF2 n/a
3 TRCN0000152229 CCAGTTCATTAAGGGCTAATA pLKO.1 2246 3UTR 100% 13.200 9.240 N SPEF2 n/a
4 TRCN0000150384 CCCTTAGAAGTAAAGGTGTAA pLKO.1 2429 3UTR 100% 4.950 3.465 N SPEF2 n/a
5 TRCN0000151655 CCTTTGAGATTAGACAGACTA pLKO.1 2176 3UTR 100% 4.950 3.465 N SPEF2 n/a
6 TRCN0000155057 GCCTCTGTTAAGACACTACCT pLKO.1 1561 CDS 100% 2.640 1.848 N SPEF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.