Transcript: Mouse NM_144784.3

Mus musculus acetyl-Coenzyme A acetyltransferase 1 (Acat1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Acat1 (110446)
Length:
3373
CDS:
76..1350

Additional Resources:

NCBI RefSeq record:
NM_144784.3
NBCI Gene record:
Acat1 (110446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119263 GCCGTACCTAAGGTTCTTAAA pLKO.1 1060 CDS 100% 13.200 18.480 N Acat1 n/a
2 TRCN0000317226 GCCGTACCTAAGGTTCTTAAA pLKO_005 1060 CDS 100% 13.200 18.480 N Acat1 n/a
3 TRCN0000313707 GTTCGGTCTGGCTAGTATTTG pLKO_005 1284 CDS 100% 13.200 18.480 N Acat1 n/a
4 TRCN0000119266 AGAGGCTCAATGTTAAGCCAT pLKO.1 971 CDS 100% 2.640 3.696 N Acat1 n/a
5 TRCN0000119265 GCTAACTGATGTCTACAATAA pLKO.1 615 CDS 100% 13.200 9.240 N Acat1 n/a
6 TRCN0000317225 GCTAACTGATGTCTACAATAA pLKO_005 615 CDS 100% 13.200 9.240 N Acat1 n/a
7 TRCN0000313708 GGGCGCAGGTTTACCTATTTC pLKO_005 393 CDS 100% 13.200 9.240 N Acat1 n/a
8 TRCN0000119262 GCCAGGTTATATTCAGCATAA pLKO.1 1410 3UTR 100% 10.800 7.560 N Acat1 n/a
9 TRCN0000317299 GCCAGGTTATATTCAGCATAA pLKO_005 1410 3UTR 100% 10.800 7.560 N Acat1 n/a
10 TRCN0000119264 CCCACTTTGAATGAAGTGGTT pLKO.1 175 CDS 100% 0.264 0.185 N Acat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.