Transcript: Mouse NM_144785.2

Mus musculus solute carrier family 22 (organic anion transporter), member 19 (Slc22a19), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Slc22a19 (207151)
Length:
1984
CDS:
118..1773

Additional Resources:

NCBI RefSeq record:
NM_144785.2
NBCI Gene record:
Slc22a19 (207151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079495 CGGATAAATGCCGTCGCTATA pLKO.1 371 CDS 100% 10.800 15.120 N Slc22a19 n/a
2 TRCN0000079497 CTAAGTTTCAAGCTCTGGTAA pLKO.1 797 CDS 100% 4.950 3.960 N Slc22a19 n/a
3 TRCN0000079496 CCAATGTTCTTACTCCTTATT pLKO.1 919 CDS 100% 13.200 9.240 N Slc22a19 n/a
4 TRCN0000079494 CCCTGGATCATCTATGGGATT pLKO.1 1606 CDS 100% 4.050 2.835 N Slc22a19 n/a
5 TRCN0000079493 CCTCTGATCAAGGAGAAAGAT pLKO.1 1788 3UTR 100% 5.625 3.375 N Slc22a19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.