Transcript: Mouse NM_144787.2

Mus musculus lysine (K)-specific demethylase 4C (Kdm4c), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-01-27
Taxon:
Mus musculus (mouse)
Gene:
Kdm4c (76804)
Length:
4271
CDS:
226..3390

Additional Resources:

NCBI RefSeq record:
NM_144787.2
NBCI Gene record:
Kdm4c (76804)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103551 GCTGGCTAACAGCAGCAAATA pLKO.1 528 CDS 100% 13.200 18.480 N Kdm4c n/a
2 TRCN0000103553 GCAAAGTATCTTGGATCAAAT pLKO.1 3082 CDS 100% 13.200 9.240 N Kdm4c n/a
3 TRCN0000325723 GCAAAGTATCTTGGATCAAAT pLKO_005 3082 CDS 100% 13.200 9.240 N Kdm4c n/a
4 TRCN0000103552 CCTATATGTATCAGGTTGAAT pLKO.1 3107 CDS 100% 5.625 3.938 N Kdm4c n/a
5 TRCN0000325649 CCTATATGTATCAGGTTGAAT pLKO_005 3107 CDS 100% 5.625 3.938 N Kdm4c n/a
6 TRCN0000103554 GCAGAGTGATAGATGTGACAT pLKO.1 2909 CDS 100% 4.950 3.465 N Kdm4c n/a
7 TRCN0000325722 GCAGAGTGATAGATGTGACAT pLKO_005 2909 CDS 100% 4.950 3.465 N Kdm4c n/a
8 TRCN0000022054 GCCCAAGTCTTGGTATGCTAT pLKO.1 843 CDS 100% 4.950 3.465 N KDM4C n/a
9 TRCN0000103550 GCAACCAAGAAGAGACATATT pLKO.1 3533 3UTR 100% 13.200 7.920 N Kdm4c n/a
10 TRCN0000325721 GCAACCAAGAAGAGACATATT pLKO_005 3533 3UTR 100% 13.200 7.920 N Kdm4c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.