Transcript: Mouse NM_144797.3

Mus musculus meteorin, glial cell differentiation regulator-like (Metrnl), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Metrnl (210029)
Length:
2468
CDS:
200..1135

Additional Resources:

NCBI RefSeq record:
NM_144797.3
NBCI Gene record:
Metrnl (210029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328513 ACTCCTCTGGAGCCAATATTT pLKO_005 537 CDS 100% 15.000 10.500 N Metrnl n/a
2 TRCN0000198015 CACGCTTTAGTGACTTTCAAA pLKO.1 1056 CDS 100% 5.625 3.938 N Metrnl n/a
3 TRCN0000177722 CGGAGAAAGATTCAATGGTTA pLKO.1 2283 3UTR 100% 4.950 3.465 N Metrnl n/a
4 TRCN0000200319 GCTTCCAGTATGAGCTGATGA pLKO.1 699 CDS 100% 4.950 3.465 N Metrnl n/a
5 TRCN0000328512 GCTTCCAGTATGAGCTGATGA pLKO_005 699 CDS 100% 4.950 3.465 N Metrnl n/a
6 TRCN0000200420 GACGTCACACATGTACCAGAA pLKO.1 836 CDS 100% 4.050 2.835 N Metrnl n/a
7 TRCN0000328568 GACGTCACACATGTACCAGAA pLKO_005 836 CDS 100% 4.050 2.835 N Metrnl n/a
8 TRCN0000182099 CCAGAACTTGACTGTGTGCAT pLKO.1 502 CDS 100% 2.640 1.848 N Metrnl n/a
9 TRCN0000328511 CCAGAACTTGACTGTGTGCAT pLKO_005 502 CDS 100% 2.640 1.848 N Metrnl n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2430 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.