Transcript: Mouse NM_144813.1

Mus musculus solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 (Slc24a1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Slc24a1 (214111)
Length:
5244
CDS:
261..3653

Additional Resources:

NCBI RefSeq record:
NM_144813.1
NBCI Gene record:
Slc24a1 (214111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428731 TGTTAGAAGATCGAATCATAT pLKO_005 3613 CDS 100% 13.200 18.480 N Slc24a1 n/a
2 TRCN0000069945 CCGACCTTCTTAACACATGAA pLKO.1 981 CDS 100% 4.950 3.960 N Slc24a1 n/a
3 TRCN0000069947 GCATCACTAAAGAACAGTTAT pLKO.1 627 CDS 100% 13.200 9.240 N Slc24a1 n/a
4 TRCN0000069946 CCTGTTTGTGATCTTCTCAAT pLKO.1 3509 CDS 100% 4.950 3.465 N Slc24a1 n/a
5 TRCN0000069943 CGTCCCTCTTACCATACCAAT pLKO.1 3709 3UTR 100% 4.950 3.465 N Slc24a1 n/a
6 TRCN0000069944 CCGGAGAATTAACAATCCCTT pLKO.1 1199 CDS 100% 2.640 1.848 N Slc24a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.