Transcript: Mouse NM_144936.1

Mus musculus transmembrane protein 45b (Tmem45b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem45b (235135)
Length:
1602
CDS:
90..926

Additional Resources:

NCBI RefSeq record:
NM_144936.1
NBCI Gene record:
Tmem45b (235135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366575 AGACTCTGTTTGCAATCATTG pLKO_005 253 CDS 100% 10.800 15.120 N Tmem45b n/a
2 TRCN0000124225 GCCATCAACTACTCCCTTGTT pLKO.1 789 CDS 100% 4.950 3.960 N Tmem45b n/a
3 TRCN0000376888 ATCACGTGCTGCTTCTGATAA pLKO_005 1392 3UTR 100% 13.200 9.240 N Tmem45b n/a
4 TRCN0000366577 GTGCTCCTAGGGCTCTATATG pLKO_005 1127 3UTR 100% 13.200 9.240 N Tmem45b n/a
5 TRCN0000379226 AGCATCTCTCTGGAGGTTATC pLKO_005 576 CDS 100% 10.800 7.560 N Tmem45b n/a
6 TRCN0000376967 TTCCGAACCAGTCTCCTTATC pLKO_005 624 CDS 100% 10.800 7.560 N Tmem45b n/a
7 TRCN0000366513 TTGTCCTGTTCCCGCCATTTG pLKO_005 676 CDS 100% 10.800 7.560 N Tmem45b n/a
8 TRCN0000124224 GCAGGTACTTTCTTCTCAGAA pLKO.1 1436 3UTR 100% 4.950 3.465 N Tmem45b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144936.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.