Transcript: Human NM_144962.3

Homo sapiens phosphatidylethanolamine binding protein 4 (PEBP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
PEBP4 (157310)
Length:
901
CDS:
99..782

Additional Resources:

NCBI RefSeq record:
NM_144962.3
NBCI Gene record:
PEBP4 (157310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073486 GCAAGGTTGTTCCTGATTGTA pLKO.1 271 CDS 100% 5.625 7.875 N PEBP4 n/a
2 TRCN0000073483 GCCTGCTAGATAGCCGGCTTT pLKO.1 774 CDS 100% 1.350 1.890 N PEBP4 n/a
3 TRCN0000378945 GACAGATTTCTGAACCGTTTC pLKO_005 630 CDS 100% 6.000 4.800 N PEBP4 n/a
4 TRCN0000073484 CGCAACCTATATCCTGGTGAT pLKO.1 359 CDS 100% 4.050 3.240 N PEBP4 n/a
5 TRCN0000373186 TCCATCGCTACCAGTTCTTTG pLKO_005 538 CDS 100% 10.800 7.560 N PEBP4 n/a
6 TRCN0000073485 GCTGCAAGGTTGTTCCTGATT pLKO.1 268 CDS 100% 4.950 3.465 N PEBP4 n/a
7 TRCN0000373142 AGATTCAGGGCCAGGAGTTAT pLKO_005 478 CDS 100% 13.200 7.920 N PEBP4 n/a
8 TRCN0000073487 TCTGGAGACATTGGCTGGTAA pLKO.1 424 CDS 100% 4.950 2.970 N PEBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.