Transcript: Human NM_145024.3

Homo sapiens carboxylesterase 5A (CES5A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CES5A (221223)
Length:
2027
CDS:
153..1730

Additional Resources:

NCBI RefSeq record:
NM_145024.3
NBCI Gene record:
CES5A (221223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046782 CAAGGTGCATTACCCGAAATT pLKO.1 476 CDS 100% 13.200 18.480 N CES5A n/a
2 TRCN0000413287 GCTGCTCTTAGATCAACATAT pLKO_005 452 CDS 100% 13.200 18.480 N CES5A n/a
3 TRCN0000430617 GCTCGAACCGGGAATCCTAAT pLKO_005 1488 CDS 100% 10.800 15.120 N CES5A n/a
4 TRCN0000417435 GCACATCCCGCCTCAGTATTT pLKO_005 1277 CDS 100% 13.200 10.560 N CES5A n/a
5 TRCN0000435670 TAATTTCTCCCGCAATCATTA pLKO_005 1772 3UTR 100% 13.200 10.560 N CES5A n/a
6 TRCN0000046779 CGGGAGCCATAAGTGTTTCTA pLKO.1 832 CDS 100% 5.625 4.500 N CES5A n/a
7 TRCN0000419339 ACAAGCTGCTTTCGCTGATAT pLKO_005 1837 3UTR 100% 13.200 9.240 N CES5A n/a
8 TRCN0000046780 GTCCTCTTTCTTCCTTAACTT pLKO.1 1666 CDS 100% 5.625 3.938 N CES5A n/a
9 TRCN0000046778 CCCTAATTTGTGCCTCCAGAA pLKO.1 422 CDS 100% 4.050 2.835 N CES5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145024.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.