Transcript: Human NM_145057.4

Homo sapiens CDC42 effector protein 5 (CDC42EP5), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CDC42EP5 (148170)
Length:
896
CDS:
375..821

Additional Resources:

NCBI RefSeq record:
NM_145057.4
NBCI Gene record:
CDC42EP5 (148170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145057.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415248 TCGAGCTGAACGACGTCATCG pLKO_005 793 CDS 100% 1.350 1.890 N CDC42EP5 n/a
2 TRCN0000048329 CACCTCGTTCCTGAGCCGCCA pLKO.1 509 CDS 100% 0.000 0.000 N CDC42EP5 n/a
3 TRCN0000048328 CTTCCGGCACACGCTGCACGT pLKO.1 461 CDS 100% 0.000 0.000 N CDC42EP5 n/a
4 TRCN0000364938 TGCTGTCCTTCCACCTGGATC pLKO_005 637 CDS 100% 1.350 0.810 N CDC42EP5 n/a
5 TRCN0000364937 AGCCCAAGAAGCGGCCTGATC pLKO_005 406 CDS 100% 0.000 0.000 N CDC42EP5 n/a
6 TRCN0000048332 CAGCCCAAGAAGCGGCCTGAT pLKO.1 405 CDS 100% 0.000 0.000 N CDC42EP5 n/a
7 TRCN0000048331 CTGCTGTCCTTCCACCTGGAT pLKO.1 636 CDS 100% 0.880 0.440 Y CDC42EP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145057.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.