Transcript: Mouse NM_145143.3

Mus musculus membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) (Mpp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mpp4 (227157)
Length:
2422
CDS:
120..2027

Additional Resources:

NCBI RefSeq record:
NM_145143.3
NBCI Gene record:
Mpp4 (227157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147203 ACCAGAATGATGCCCTCTGG pXPR_003 TGG 852 45% 10 0.5197 Mpp4 MPP4 77114
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362093 ACTTGAAGCCCTACGTTATAT pLKO_005 1726 CDS 100% 15.000 21.000 N Mpp4 n/a
2 TRCN0000024164 CCTGAGCAAGTGATCCATATT pLKO.1 753 CDS 100% 13.200 9.240 N Mpp4 n/a
3 TRCN0000024168 GCAGAAGCTAAGGACGAATTT pLKO.1 1197 CDS 100% 13.200 9.240 N Mpp4 n/a
4 TRCN0000362169 TGCCCTAAAGATCCGGAATAA pLKO_005 2064 3UTR 100% 13.200 9.240 N Mpp4 n/a
5 TRCN0000362170 TGTTCGCGCCATGATTGATTA pLKO_005 854 CDS 100% 13.200 9.240 N Mpp4 n/a
6 TRCN0000024167 CCCTTCTAACCACCTTCTGAA pLKO.1 1022 CDS 100% 4.950 3.465 N Mpp4 n/a
7 TRCN0000024166 GCTGGAGTATGGTGAGTACAA pLKO.1 1595 CDS 100% 4.950 3.465 N Mpp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145143.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.