Transcript: Mouse NM_145158.3

Mus musculus elastin microfibril interfacer 2 (Emilin2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Emilin2 (246707)
Length:
3910
CDS:
106..3330

Additional Resources:

NCBI RefSeq record:
NM_145158.3
NBCI Gene record:
Emilin2 (246707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257587 AGCTCGACGCAAGGATCAATG pLKO_005 1475 CDS 100% 10.800 15.120 N Emilin2 n/a
2 TRCN0000202085 CCTGGTGTATCGGGTAAACTT pLKO.1 366 CDS 100% 5.625 7.875 N Emilin2 n/a
3 TRCN0000246910 AGATGAACGGGACGCTCAAAT pLKO_005 2330 CDS 100% 13.200 9.240 N Emilin2 n/a
4 TRCN0000246912 GTGCGCCTACATCGTGAATAA pLKO_005 255 CDS 100% 13.200 9.240 N Emilin2 n/a
5 TRCN0000257599 GACAACCAGAAGACTCGTTAT pLKO_005 3508 3UTR 100% 10.800 7.560 N Emilin2 n/a
6 TRCN0000246911 GAGAATGAGCAGGTCCTAATG pLKO_005 1705 CDS 100% 10.800 7.560 N Emilin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145158.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.