Transcript: Human NM_145168.3

Homo sapiens short chain dehydrogenase/reductase family 42E, member 1 (SDR42E1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SDR42E1 (93517)
Length:
11548
CDS:
111..1292

Additional Resources:

NCBI RefSeq record:
NM_145168.3
NBCI Gene record:
SDR42E1 (93517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420713 GAGGGCAAGATATACTTATTT pLKO_005 1607 3UTR 100% 15.000 21.000 N SDR42E1 n/a
2 TRCN0000414238 TACTCTCGGACAAAGTCAATT pLKO_005 564 CDS 100% 13.200 18.480 N SDR42E1 n/a
3 TRCN0000028410 GCAACTCAATCGAAACCTGAT pLKO.1 374 CDS 100% 4.050 5.670 N SDR42E1 n/a
4 TRCN0000412489 GAAGCAGTGGAATGGTTTAAA pLKO_005 1143 CDS 100% 15.000 10.500 N SDR42E1 n/a
5 TRCN0000432328 TTGGTCTTCCTCCTGATTATA pLKO_005 1227 CDS 100% 15.000 10.500 N SDR42E1 n/a
6 TRCN0000028437 GCCAAGAAAGAGCTAGGTTAT pLKO.1 1098 CDS 100% 10.800 7.560 N SDR42E1 n/a
7 TRCN0000028405 CCATGTGATTCTGTTTGACAT pLKO.1 209 CDS 100% 4.950 3.465 N SDR42E1 n/a
8 TRCN0000028461 CCTGCCATTGACCTTGGTCTA pLKO.1 953 CDS 100% 4.050 2.835 N SDR42E1 n/a
9 TRCN0000028458 CCTGCTCAAACCATTCCAGAA pLKO.1 237 CDS 100% 4.050 2.835 N SDR42E1 n/a
10 TRCN0000414405 CTCTTCAAATTGCTACTTAAG pLKO_005 1392 3UTR 100% 10.800 6.480 N SDR42E1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8926 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8926 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.