Transcript: Mouse NM_145226.2

Mus musculus 2'-5' oligoadenylate synthetase 3 (Oas3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Oas3 (246727)
Length:
4718
CDS:
36..3452

Additional Resources:

NCBI RefSeq record:
NM_145226.2
NBCI Gene record:
Oas3 (246727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075825 CCAGGTTGTCACTCGATATAA pLKO.1 2018 CDS 100% 15.000 10.500 N Oas3 n/a
2 TRCN0000075827 CCAGCCAAGCTTAAGAACTTA pLKO.1 618 CDS 100% 5.625 3.938 N Oas3 n/a
3 TRCN0000075826 CGGGAGAAGAGTGTATACAAA pLKO.1 1527 CDS 100% 5.625 3.938 N Oas3 n/a
4 TRCN0000075824 CCTCCAGTTTATTGAACAGAA pLKO.1 1739 CDS 100% 4.950 3.465 N Oas3 n/a
5 TRCN0000075823 GCTGGTAGTCTTGAGTTCTAT pLKO.1 4531 3UTR 100% 5.625 3.375 N Oas3 n/a
6 TRCN0000320373 TCTACTGGACGGTCAACTATA pLKO_005 2197 CDS 100% 13.200 9.240 N OAS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.