Transcript: Mouse NM_145228.2

Mus musculus 2'-5' oligoadenylate synthetase 1H (Oas1h), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Oas1h (246729)
Length:
1708
CDS:
33..1142

Additional Resources:

NCBI RefSeq record:
NM_145228.2
NBCI Gene record:
Oas1h (246729)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417015 ACGACTGAGAGAGAAGTTTAA pLKO_005 395 CDS 100% 13.200 18.480 N Oas1h n/a
2 TRCN0000075804 CGACCTATTGGTATTCTTTAA pLKO.1 284 CDS 100% 13.200 18.480 N Oas1h n/a
3 TRCN0000075805 CGTTCTACATGAACAGGTCAA pLKO.1 905 CDS 100% 4.050 3.240 N Oas1h n/a
4 TRCN0000431441 GCTCAGACCAGCCCAACTTTA pLKO_005 424 CDS 100% 13.200 9.240 N Oas1h n/a
5 TRCN0000412816 GAAATCTACAACAAAGTATAC pLKO_005 558 CDS 100% 10.800 7.560 N Oas1h n/a
6 TRCN0000075807 CCGTCTTAGAACTGATCACTA pLKO.1 844 CDS 100% 4.950 3.465 N Oas1h n/a
7 TRCN0000075806 GATCAGTTCAAGCTACAGAAA pLKO.1 324 CDS 100% 4.950 3.465 N Oas1h n/a
8 TRCN0000075803 GCTCCTCTGCTGTAAGACTTT pLKO.1 1187 3UTR 100% 4.950 2.970 N Oas1h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.