Transcript: Mouse NM_145356.3

Mus musculus zinc finger and BTB domain containing 7C (Zbtb7c), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Zbtb7c (207259)
Length:
4591
CDS:
481..2340

Additional Resources:

NCBI RefSeq record:
NM_145356.3
NBCI Gene record:
Zbtb7c (207259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124447 CCTACGTGTATGAGATCGACT pLKO.1 695 CDS 100% 2.640 3.696 N Zbtb7c n/a
2 TRCN0000124444 CCACGCTTTCTTGAATTTGTA pLKO.1 3659 3UTR 100% 5.625 3.938 N Zbtb7c n/a
3 TRCN0000124448 CATCTGCCACAAGGTCATCAT pLKO.1 1581 CDS 100% 4.950 3.465 N Zbtb7c n/a
4 TRCN0000124446 CTGACAGAAGACCCTCCTTAT pLKO.1 1205 CDS 100% 10.800 6.480 N Zbtb7c n/a
5 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 956 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.