Transcript: Mouse NM_145369.3

Mus musculus WAP four-disulfide core domain 5 (Wfdc5), mRNA.

Source:
NCBI, updated 2017-05-12
Taxon:
Mus musculus (mouse)
Gene:
Wfdc5 (209232)
Length:
2324
CDS:
90..470

Additional Resources:

NCBI RefSeq record:
NM_145369.3
NBCI Gene record:
Wfdc5 (209232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113208 CGATGGACTCTGCAACCAGAA pLKO.1 200 CDS 100% 4.050 3.240 N Wfdc5 n/a
2 TRCN0000113207 TCTTTGTAAAGTCGGGCAAAT pLKO.1 313 CDS 100% 10.800 7.560 N Wfdc5 n/a
3 TRCN0000113209 CCTCCTGATCAGTGCTTGAAT pLKO.1 225 CDS 100% 5.625 3.938 N Wfdc5 n/a
4 TRCN0000113205 CCAGTGTTATATCTCTCTGTA pLKO.1 767 3UTR 100% 4.950 3.465 N Wfdc5 n/a
5 TRCN0000113206 GCCTGTTGCCTTGTGTAGAAA pLKO.1 146 CDS 100% 5.625 3.375 N Wfdc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.