Transcript: Mouse NM_145378.4

Mus musculus phospholipase A2, group IVB (cytosolic) (Pla2g4b), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pla2g4b (211429)
Length:
3859
CDS:
66..2441

Additional Resources:

NCBI RefSeq record:
NM_145378.4
NBCI Gene record:
Pla2g4b (211429)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251879 ACACTGTGACACGGAACATTT pLKO_005 2715 3UTR 100% 13.200 6.600 Y Pla2g4b n/a
2 TRCN0000251880 AGAACCCTCTGCCTATCTATT pLKO_005 1375 CDS 100% 13.200 6.600 Y Pla2g4b n/a
3 TRCN0000251876 CATTTCCACAAGGACTATTTC pLKO_005 1818 CDS 100% 13.200 6.600 Y Pla2g4b n/a
4 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 3700 3UTR 100% 13.200 6.600 Y Ptcra n/a
5 TRCN0000251877 GCCTTCCAAGGACCTAGTAAC pLKO_005 155 CDS 100% 10.800 5.400 Y Pla2g4b n/a
6 TRCN0000251878 GCTGTTACGGCTGACGCATTA pLKO_005 2330 CDS 100% 10.800 5.400 Y Pla2g4b n/a
7 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 3556 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145378.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.