Transcript: Mouse NM_145417.3

Mus musculus arginyl aminopeptidase (aminopeptidase B) (Rnpep), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rnpep (215615)
Length:
2301
CDS:
77..2029

Additional Resources:

NCBI RefSeq record:
NM_145417.3
NBCI Gene record:
Rnpep (215615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031118 GCGGTCTTAAACCGAGCCTTT pLKO.1 590 CDS 100% 4.050 5.670 N Rnpep n/a
2 TRCN0000353847 GCGGTCTTAAACCGAGCCTTT pLKO_005 590 CDS 100% 4.050 5.670 N Rnpep n/a
3 TRCN0000031117 GCCTATGTAGATGAGTTTAAA pLKO.1 1394 CDS 100% 15.000 10.500 N Rnpep n/a
4 TRCN0000324276 GCCTATGTAGATGAGTTTAAA pLKO_005 1394 CDS 100% 15.000 10.500 N Rnpep n/a
5 TRCN0000031116 GCTTGTCTACTTCCTAGATAA pLKO.1 1678 CDS 100% 13.200 9.240 N Rnpep n/a
6 TRCN0000324275 GCTTGTCTACTTCCTAGATAA pLKO_005 1678 CDS 100% 13.200 9.240 N Rnpep n/a
7 TRCN0000031114 GAGCTTCTGTTCTTTGGGTTT pLKO.1 2125 3UTR 100% 4.050 2.835 N Rnpep n/a
8 TRCN0000324214 GAGCTTCTGTTCTTTGGGTTT pLKO_005 2125 3UTR 100% 4.050 2.835 N Rnpep n/a
9 TRCN0000031115 GCTCTTATTGAGGTTCCAGAT pLKO.1 653 CDS 100% 4.050 2.835 N Rnpep n/a
10 TRCN0000324278 GCTCTTATTGAGGTTCCAGAT pLKO_005 653 CDS 100% 4.050 2.835 N Rnpep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145417.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.