Transcript: Mouse NM_145418.4

Mus musculus glycoprotein integral membrane 1 (Ginm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ginm1 (215751)
Length:
1557
CDS:
44..1027

Additional Resources:

NCBI RefSeq record:
NM_145418.4
NBCI Gene record:
Ginm1 (215751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126119 GCTGGAGAACTTAACATTTAT pLKO.1 1367 3UTR 100% 15.000 10.500 N Ginm1 n/a
2 TRCN0000323765 GCTGGAGAACTTAACATTTAT pLKO_005 1367 3UTR 100% 15.000 10.500 N Ginm1 n/a
3 TRCN0000126121 GCATCCAAATCAATGTAACTA pLKO.1 162 CDS 100% 5.625 3.938 N Ginm1 n/a
4 TRCN0000323697 GCATCCAAATCAATGTAACTA pLKO_005 162 CDS 100% 5.625 3.938 N Ginm1 n/a
5 TRCN0000126123 AGCAGGAGTCATAGCAGTGTT pLKO.1 868 CDS 100% 4.950 3.465 N Ginm1 n/a
6 TRCN0000126120 GCAGGAGTCATAGCAGTGTTA pLKO.1 869 CDS 100% 4.950 3.465 N Ginm1 n/a
7 TRCN0000323699 GCAGGAGTCATAGCAGTGTTA pLKO_005 869 CDS 100% 4.950 3.465 N Ginm1 n/a
8 TRCN0000126122 CCCGAATAAGCTGTCAGACTT pLKO.1 288 CDS 100% 4.950 2.970 N Ginm1 n/a
9 TRCN0000323764 CCCGAATAAGCTGTCAGACTT pLKO_005 288 CDS 100% 4.950 2.970 N Ginm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.