Transcript: Mouse NM_145437.2

Mus musculus CD300 molecule like family member d (Cd300ld), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cd300ld (217305)
Length:
2440
CDS:
77..742

Additional Resources:

NCBI RefSeq record:
NM_145437.2
NBCI Gene record:
Cd300ld (217305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100030 GCCAGTTGATTGACCAAATAT pLKO.1 1407 3UTR 100% 15.000 10.500 N Cd300ld n/a
2 TRCN0000100033 CAGAGATCATGTGATATTCTT pLKO.1 251 CDS 100% 5.625 3.938 N Cd300ld n/a
3 TRCN0000100032 CTGATGGTCTTTGTGGAGTTA pLKO.1 614 CDS 100% 4.950 3.465 N Cd300ld n/a
4 TRCN0000100031 GCAGTGCAGATATTCCTCATA pLKO.1 190 CDS 100% 4.950 3.465 N Cd300ld n/a
5 TRCN0000439453 ATGAGCGATGCTGGCATTTAC pLKO_005 374 CDS 100% 13.200 6.600 Y Cd300lf n/a
6 TRCN0000272148 TTGACAGTGCAGTGCAGATAT pLKO_005 182 CDS 100% 13.200 6.600 Y Cd300ld5 n/a
7 TRCN0000438034 TGACAGTGCAGTGCAGATATG pLKO_005 183 CDS 100% 10.800 5.400 Y Cd300ld3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2197 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.