Transcript: Mouse NM_145515.2

Mus musculus MAP/microtubule affinity regulating kinase 1 (Mark1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Mark1 (226778)
Length:
4565
CDS:
78..2465

Additional Resources:

NCBI RefSeq record:
NM_145515.2
NBCI Gene record:
Mark1 (226778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149223 GTAATGGAGTTTCTACACCG pXPR_003 GGG 126 5% 2 0.4973 Mark1 MARK1 77796
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322317 GGTCCGCTTCAAGCGAATATC pLKO_005 2384 CDS 100% 13.200 18.480 N Mark1 n/a
2 TRCN0000322376 TTAGTGCTGAATCCCATAAAG pLKO_005 951 CDS 100% 13.200 18.480 N Mark1 n/a
3 TRCN0000322316 GCCCAAGTAACAACGTATATT pLKO_005 1540 CDS 100% 15.000 12.000 N Mark1 n/a
4 TRCN0000362088 GTGAAGTCTTTGATTACTTAG pLKO_005 502 CDS 100% 10.800 8.640 N Mark1 n/a
5 TRCN0000322319 CAAGTCAGTATGAGCTATAAT pLKO_005 2619 3UTR 100% 15.000 10.500 N Mark1 n/a
6 TRCN0000322377 GTTACACTGCCAACCATTAAA pLKO_005 1767 CDS 100% 15.000 10.500 N Mark1 n/a
7 TRCN0000362163 CTTAATGCAATAAGGTTATAC pLKO_005 2577 3UTR 100% 13.200 9.240 N Mark1 n/a
8 TRCN0000024173 CTGGGACATCTATTGCCTTTA pLKO.1 2404 CDS 100% 10.800 7.560 N Mark1 n/a
9 TRCN0000362087 TACTGAACCATCCTAACATAG pLKO_005 415 CDS 100% 10.800 7.560 N Mark1 n/a
10 TRCN0000024170 CCTAACATAGTGAAACTGTTT pLKO.1 426 CDS 100% 4.950 3.465 N Mark1 n/a
11 TRCN0000024171 CGAGCCCAAGTAACAACGTAT pLKO.1 1537 CDS 100% 4.950 3.465 N Mark1 n/a
12 TRCN0000024169 CGTGCCAAATTCAGGCAGATT pLKO.1 555 CDS 100% 4.950 3.465 N Mark1 n/a
13 TRCN0000196780 GATGAAGTTATGGCTACTTAT pLKO.1 1152 CDS 100% 13.200 18.480 N MARK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.