Transcript: Mouse NM_145519.2

Mus musculus FERM, RhoGEF and pleckstrin domain protein 2 (Farp2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Farp2 (227377)
Length:
3929
CDS:
110..3307

Additional Resources:

NCBI RefSeq record:
NM_145519.2
NBCI Gene record:
Farp2 (227377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120385 CAGTCGGAAATCGGAGATTAT pLKO.1 614 CDS 100% 13.200 18.480 N Farp2 n/a
2 TRCN0000120383 GCAGTCGGAAATCGGAGATTA pLKO.1 613 CDS 100% 13.200 18.480 N Farp2 n/a
3 TRCN0000120386 CTCAGGAACATGCGTCAGTTA pLKO.1 1988 CDS 100% 4.950 3.465 N Farp2 n/a
4 TRCN0000120382 GCCCTAAATACAGGTTGGATT pLKO.1 3540 3UTR 100% 4.950 3.465 N Farp2 n/a
5 TRCN0000120384 CCAATTCAAATCTCACGTCTA pLKO.1 3103 CDS 100% 4.050 2.835 N Farp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145519.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.