Transcript: Mouse NM_145540.3

Mus musculus integrator complex subunit 3 (Ints3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ints3 (229543)
Length:
4460
CDS:
687..3812

Additional Resources:

NCBI RefSeq record:
NM_145540.3
NBCI Gene record:
Ints3 (229543)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123433 CCTGTTTGACAACCCTAAATT pLKO.1 2105 CDS 100% 15.000 21.000 N Ints3 n/a
2 TRCN0000287518 CCTGTTTGACAACCCTAAATT pLKO_005 2105 CDS 100% 15.000 21.000 N Ints3 n/a
3 TRCN0000295071 GGAAACCACTGTACCTAATAT pLKO_005 2629 CDS 100% 15.000 21.000 N Ints3 n/a
4 TRCN0000295002 TGATGATGAGGAGGATCTTAA pLKO_005 2291 CDS 100% 13.200 9.240 N Ints3 n/a
5 TRCN0000074394 CGGAGGAATATGAGGACTCTT pLKO.1 3601 CDS 100% 4.950 3.465 N INTS3 n/a
6 TRCN0000123430 GCAGGGAAGATGAACCTGTAT pLKO.1 2784 CDS 100% 4.950 3.465 N Ints3 n/a
7 TRCN0000123431 GCTGCTACTTTCAACCAGTTT pLKO.1 788 CDS 100% 4.950 3.465 N Ints3 n/a
8 TRCN0000287519 GCTGCTACTTTCAACCAGTTT pLKO_005 788 CDS 100% 4.950 3.465 N Ints3 n/a
9 TRCN0000123432 CGACTTATTGTGGACCACCAT pLKO.1 1323 CDS 100% 2.640 1.848 N Ints3 n/a
10 TRCN0000123429 GCTTCCTGTCAGTCTGCATTT pLKO.1 4103 3UTR 100% 10.800 6.480 N Ints3 n/a
11 TRCN0000287598 GCTTCCTGTCAGTCTGCATTT pLKO_005 4103 3UTR 100% 10.800 6.480 N Ints3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.