Transcript: Mouse NM_145581.2

Mus musculus sialic acid binding Ig-like lectin F (Siglecf), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Siglecf (233186)
Length:
2529
CDS:
105..1814

Additional Resources:

NCBI RefSeq record:
NM_145581.2
NBCI Gene record:
Siglecf (233186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094305 CCTCCACCATAAATAGTGCAA pLKO.1 1561 CDS 100% 2.640 2.112 N Siglecf n/a
2 TRCN0000094307 GCTTGGAGTGACAATAGAGTT pLKO.1 1320 CDS 100% 4.950 3.465 N Siglecf n/a
3 TRCN0000094304 GCCCTCTAAACCAAAGGCTAT pLKO.1 1908 3UTR 100% 4.050 2.835 N Siglecf n/a
4 TRCN0000094306 CACCATAAATAGTGCAAGCAT pLKO.1 1565 CDS 100% 3.000 2.100 N Siglecf n/a
5 TRCN0000094308 GCCTCAGAACACGGAGGCTAT pLKO.1 1754 CDS 100% 0.135 0.095 N Siglecf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145581.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.