Transcript: Mouse NM_145588.1

Mus musculus kinesin family member 22 (Kif22), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Kif22 (110033)
Length:
2086
CDS:
20..2002

Additional Resources:

NCBI RefSeq record:
NM_145588.1
NBCI Gene record:
Kif22 (110033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091152 ACGCTCAAATATCAGTTTGAT pLKO.1 257 CDS 100% 0.563 0.788 N Kif22 n/a
2 TRCN0000091151 CGTGAACGTTTGACTCCATTT pLKO.1 773 CDS 100% 10.800 8.640 N Kif22 n/a
3 TRCN0000331883 CGTGAACGTTTGACTCCATTT pLKO_005 773 CDS 100% 10.800 8.640 N Kif22 n/a
4 TRCN0000091148 CCAGGATACAATTTCAGCATT pLKO.1 1060 CDS 100% 4.950 3.465 N Kif22 n/a
5 TRCN0000303169 CCAGGATACAATTTCAGCATT pLKO_005 1060 CDS 100% 4.950 3.465 N Kif22 n/a
6 TRCN0000091149 CCTGTTAAGCTGTCTCAGAAA pLKO.1 1157 CDS 100% 4.950 3.465 N Kif22 n/a
7 TRCN0000303168 CCTGTTAAGCTGTCTCAGAAA pLKO_005 1157 CDS 100% 4.950 3.465 N Kif22 n/a
8 TRCN0000091150 CCTCTTACAGAAGCTAAGCAA pLKO.1 1285 CDS 100% 3.000 1.500 Y Kif22 n/a
9 TRCN0000303170 CCTCTTACAGAAGCTAAGCAA pLKO_005 1285 CDS 100% 3.000 1.500 Y Kif22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.