Transcript: Mouse NM_145594.2

Mus musculus fibrinogen-like protein 1 (Fgl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fgl1 (234199)
Length:
1120
CDS:
89..1033

Additional Resources:

NCBI RefSeq record:
NM_145594.2
NBCI Gene record:
Fgl1 (234199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089518 CGGATTTAAGCAGAGTGGATT pLKO.1 361 CDS 100% 4.950 6.930 N Fgl1 n/a
2 TRCN0000325537 CGGATTTAAGCAGAGTGGATT pLKO_005 361 CDS 100% 4.950 6.930 N Fgl1 n/a
3 TRCN0000089521 GCTAACTATTCAAGGAGACTA pLKO.1 583 CDS 100% 4.950 6.930 N Fgl1 n/a
4 TRCN0000325606 GCTAACTATTCAAGGAGACTA pLKO_005 583 CDS 100% 4.950 6.930 N Fgl1 n/a
5 TRCN0000089520 GTATGCAGATTGTTCAGAGAT pLKO.1 331 CDS 100% 4.950 3.465 N Fgl1 n/a
6 TRCN0000325609 GTATGCAGATTGTTCAGAGAT pLKO_005 331 CDS 100% 4.950 3.465 N Fgl1 n/a
7 TRCN0000089522 CCATTGCTCTGATGATGGGAA pLKO.1 120 CDS 100% 2.640 1.848 N Fgl1 n/a
8 TRCN0000325535 CCATTGCTCTGATGATGGGAA pLKO_005 120 CDS 100% 2.640 1.848 N Fgl1 n/a
9 TRCN0000089519 GCTTTGGAAACTTTGTCCAAA pLKO.1 522 CDS 100% 0.495 0.347 N Fgl1 n/a
10 TRCN0000325534 GCTTTGGAAACTTTGTCCAAA pLKO_005 522 CDS 100% 0.495 0.347 N Fgl1 n/a
11 TRCN0000157414 GACGATCTGATGGCAGTGAAA pLKO.1 468 CDS 100% 4.950 3.465 N FGL1 n/a
12 TRCN0000319091 GACGATCTGATGGCAGTGAAA pLKO_005 468 CDS 100% 4.950 3.465 N FGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145594.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.