Transcript: Human NM_145702.3

Homo sapiens tigger transposable element derived 1 (TIGD1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TIGD1 (200765)
Length:
2588
CDS:
676..2451

Additional Resources:

NCBI RefSeq record:
NM_145702.3
NBCI Gene record:
TIGD1 (200765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140947 CGGCAAACAGTTAGCCAAGTT pLKO.1 805 CDS 100% 4.950 3.465 N TIGD1 n/a
2 TRCN0000144297 CGCACATCTCTCACTTTAAAT pLKO.1 709 CDS 100% 15.000 9.000 N TIGD1 n/a
3 TRCN0000140999 CGCATGCTACAGAGAAATCTT pLKO.1 2256 CDS 100% 5.625 3.375 N TIGD1 n/a
4 TRCN0000144482 CACGAATGATAAGAAAGCGAA pLKO.1 881 CDS 100% 2.640 1.584 N TIGD1 n/a
5 TRCN0000139011 CGCAACATTCCCTTAAGCCAA pLKO.1 961 CDS 100% 2.640 1.584 N TIGD1 n/a
6 TRCN0000141783 GCGCAAAGAAAGTGGTTTCTT pLKO.1 2068 CDS 100% 0.563 0.338 N TIGD1 n/a
7 TRCN0000140998 CCTGCTAACACAACATCCATT pLKO.1 1645 CDS 100% 4.950 2.475 Y TIGD1 n/a
8 TRCN0000140699 GCCTGCTAACACAACATCCAT pLKO.1 1644 CDS 100% 3.000 1.500 Y TIGD1 n/a
9 TRCN0000144741 GCAAAGAAAGTGGTTTCTTGA pLKO.1 2070 CDS 100% 0.495 0.248 Y TIGD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145702.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.