Transcript: Mouse NM_145822.2

Mus musculus CD3E antigen, epsilon polypeptide associated protein (Cd3eap), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cd3eap (70333)
Length:
2248
CDS:
75..1274

Additional Resources:

NCBI RefSeq record:
NM_145822.2
NBCI Gene record:
Cd3eap (70333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437838 GATGGTATAGTGGCTGACTCT pLKO_005 951 CDS 100% 2.640 3.696 N Cd3eap n/a
2 TRCN0000191685 GAAGAGAAAGAGGTATTTCAT pLKO.1 713 CDS 100% 5.625 3.938 N Cd3eap n/a
3 TRCN0000189758 GCTGCACTTCCAGATGACTTT pLKO.1 1197 CDS 100% 4.950 3.465 N Cd3eap n/a
4 TRCN0000423343 GTGACCGAACATTCAGAACAT pLKO_005 1098 CDS 100% 4.950 3.465 N Cd3eap n/a
5 TRCN0000189545 CCAGATACAGAACTGTGGCTT pLKO.1 186 CDS 100% 2.640 1.848 N Cd3eap n/a
6 TRCN0000200994 CCTCAAGAATATCTTCTCTCT pLKO.1 435 CDS 100% 2.640 1.848 N Cd3eap n/a
7 TRCN0000202351 GAGGTATTTCATGCAGGAGGA pLKO.1 722 CDS 100% 2.160 1.512 N Cd3eap n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 1265 CDS 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145822.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.