Transcript: Mouse NM_145837.3

Mus musculus interleukin 17D (Il17d), mRNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Mus musculus (mouse)
Gene:
Il17d (239114)
Length:
1232
CDS:
79..696

Additional Resources:

NCBI RefSeq record:
NM_145837.3
NBCI Gene record:
Il17d (239114)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145837.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066855 CTTTCGCAGCACACCCGTCTT pLKO.1 489 CDS 100% 1.350 1.890 N Il17d n/a
2 TRCN0000066856 CAGTGCGAACTCCAGCATGGA pLKO.1 633 CDS 100% 0.880 1.232 N Il17d n/a
3 TRCN0000066853 CGCCGAACACTACATCACCAT pLKO.1 567 CDS 100% 2.640 1.848 N Il17d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145837.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.