Transcript: Human NM_145887.4

Homo sapiens p53-induced death domain protein 1 (PIDD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-16
Taxon:
Homo sapiens (human)
Gene:
PIDD1 (55367)
Length:
2933
CDS:
129..2810

Additional Resources:

NCBI RefSeq record:
NM_145887.4
NBCI Gene record:
PIDD1 (55367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277643 ACACGCTACCTCCTGAGATTG pLKO_005 748 CDS 100% 10.800 8.640 N PIDD1 n/a
2 TRCN0000165404 CGATCTCTCTCAGAATCTGCT pLKO.1 725 CDS 100% 2.640 2.112 N PIDD1 n/a
3 TRCN0000165793 CTGCTTTGTCTTCTACTCGCA pLKO.1 2198 CDS 100% 0.660 0.528 N PIDD1 n/a
4 TRCN0000277642 TCGAGGGCGAAGAGTTCTTTG pLKO_005 2116 CDS 100% 10.800 7.560 N PIDD1 n/a
5 TRCN0000286011 TCTCCTTGGCACCCTTGAATC pLKO_005 2392 CDS 100% 10.800 7.560 N PIDD1 n/a
6 TRCN0000161758 CAGAATCTGCTTTGTCTTCTA pLKO.1 2192 CDS 100% 4.950 3.465 N PIDD1 n/a
7 TRCN0000166358 CCTCGATCTCTCTCAGAATCT pLKO.1 722 CDS 100% 4.950 3.465 N PIDD1 n/a
8 TRCN0000161542 GAATCTGCTTTGTCTTCTACT pLKO.1 2194 CDS 100% 4.950 3.465 N PIDD1 n/a
9 TRCN0000165276 GACTGTTCCTGACCTCAGATT pLKO.1 1075 CDS 100% 4.950 3.465 N PIDD1 n/a
10 TRCN0000165612 GACCTCAGATTTGGACAGCTT pLKO.1 1085 CDS 100% 2.640 1.848 N PIDD1 n/a
11 TRCN0000165220 GCACCTGAAGAATGTGAAGGA pLKO.1 2216 CDS 100% 2.640 1.848 N PIDD1 n/a
12 TRCN0000277644 GCACCTGAAGAATGTGAAGGA pLKO_005 2216 CDS 100% 2.640 1.848 N PIDD1 n/a
13 TRCN0000277702 GGCAGCCCTCATTCCAGAAAT pLKO_005 1049 CDS 100% 13.200 7.920 N PIDD1 n/a
14 TRCN0000166743 CAGGAGATGCTTCAGAGGATT pLKO.1 175 CDS 100% 4.950 2.970 N PIDD1 n/a
15 TRCN0000164999 CTTTGTCTTCTACTCGCACCT pLKO.1 2201 CDS 100% 2.160 1.296 N PIDD1 n/a
16 TRCN0000163959 CTGAAGAATGTGAAGGAGGTA pLKO.1 2220 CDS 100% 2.640 1.584 N PIDD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.