Transcript: Mouse NM_145930.2

Mus musculus expressed sequence AW549877 (AW549877), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
AW549877 (106064)
Length:
5094
CDS:
39..923

Additional Resources:

NCBI RefSeq record:
NM_145930.2
NBCI Gene record:
AW549877 (106064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328766 CATCCTGGACATGACATATTT pLKO_005 248 CDS 100% 15.000 21.000 N AW549877 n/a
2 TRCN0000328820 TATTGTCATTCGCTGACTAAG pLKO_005 462 CDS 100% 10.800 15.120 N AW549877 n/a
3 TRCN0000198353 GTATTGTCATTCGCTGACTAA pLKO.1 461 CDS 100% 4.950 6.930 N AW549877 n/a
4 TRCN0000328818 ATCGATGCCCTGTCCAGTTAA pLKO_005 568 CDS 100% 13.200 10.560 N AW549877 n/a
5 TRCN0000199001 GTACCTTGTTGATGGGATCAA pLKO.1 524 CDS 100% 0.000 0.000 N AW549877 n/a
6 TRCN0000328819 ACCTTGTTGATGGGATCAATT pLKO_005 526 CDS 100% 13.200 9.240 N AW549877 n/a
7 TRCN0000328764 AGCTATAAATGTAGGCAATTA pLKO_005 1331 3UTR 100% 13.200 9.240 N AW549877 n/a
8 TRCN0000216278 CAAACGCAAAGCAAATCTTAA pLKO.1 877 CDS 100% 13.200 9.240 N AW549877 n/a
9 TRCN0000197577 CCACATAACAATAAGCCTATA pLKO.1 3746 3UTR 100% 10.800 7.560 N AW549877 n/a
10 TRCN0000177157 GCTGTGCATTATTTCATGTTA pLKO.1 4561 3UTR 100% 5.625 3.938 N AW549877 n/a
11 TRCN0000178367 GCCTTTCAGTAAGACTGAAAT pLKO.1 1611 3UTR 100% 1.320 0.924 N AW549877 n/a
12 TRCN0000182376 GCCATCCTGGACATGACATAT pLKO.1 246 CDS 100% 13.200 7.920 N AW549877 n/a
13 TRCN0000134640 GAGAACAAGCTAGTAGATGAA pLKO.1 273 CDS 100% 4.950 3.465 N C5orf51 n/a
14 TRCN0000135895 GCTATGATGTACAGTGGAGAA pLKO.1 666 CDS 100% 4.050 2.835 N C5orf51 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.