Transcript: Mouse NM_145947.2

Mus musculus solute carrier family 26, member 7 (Slc26a7), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc26a7 (208890)
Length:
2371
CDS:
131..2101

Additional Resources:

NCBI RefSeq record:
NM_145947.2
NBCI Gene record:
Slc26a7 (208890)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069358 CGCAGTACAATCTGAAGGAAA pLKO.1 246 CDS 100% 4.950 6.930 N Slc26a7 n/a
2 TRCN0000069360 CCAGCCATCATTTATGCTATA pLKO.1 386 CDS 100% 10.800 8.640 N Slc26a7 n/a
3 TRCN0000069359 CCGCCTCATTTGCTTGCTATT pLKO.1 933 CDS 100% 10.800 8.640 N Slc26a7 n/a
4 TRCN0000069361 CCTAAAGGAAAGTGACAGCAA pLKO.1 1711 CDS 100% 2.640 1.848 N Slc26a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145947.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.