Transcript: Mouse NM_145954.1

Mus musculus aldehyde dehydrogenase 16 family, member A1 (Aldh16a1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Aldh16a1 (69748)
Length:
2586
CDS:
58..2466

Additional Resources:

NCBI RefSeq record:
NM_145954.1
NBCI Gene record:
Aldh16a1 (69748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197799 GAATATCAACTACGACACATT pLKO.1 1554 CDS 100% 4.950 6.930 N Aldh16a1 n/a
2 TRCN0000248684 AGTCCTTCCTTTGTGAGAATA pLKO_005 1538 CDS 100% 13.200 9.240 N Aldh16a1 n/a
3 TRCN0000248682 AGGCCAGAATGGCACAGATAC pLKO_005 1028 CDS 100% 10.800 7.560 N Aldh16a1 n/a
4 TRCN0000248683 TCTTGGGCCACCATGTCAATG pLKO_005 173 CDS 100% 10.800 7.560 N Aldh16a1 n/a
5 TRCN0000248680 TGGGCACAGTGTGGATCAATG pLKO_005 1397 CDS 100% 10.800 7.560 N Aldh16a1 n/a
6 TRCN0000176606 CCTTTGTGAGAATATCAACTA pLKO.1 1545 CDS 100% 4.950 3.465 N Aldh16a1 n/a
7 TRCN0000182639 GCACAGAGTCACTGTTGCTAT pLKO.1 878 CDS 100% 4.950 3.465 N Aldh16a1 n/a
8 TRCN0000248681 ACAGAGTCACTGTTGCTATTG pLKO_005 880 CDS 100% 10.800 6.480 N Aldh16a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.