Transcript: Mouse NM_145955.3

Mus musculus minichromosome maintenance complex binding protein (Mcmbp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mcmbp (210711)
Length:
4171
CDS:
240..2168

Additional Resources:

NCBI RefSeq record:
NM_145955.3
NBCI Gene record:
Mcmbp (210711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176032 GCGTACTGAATAGTGAGGAAA pLKO.1 1045 CDS 100% 4.950 6.930 N Mcmbp n/a
2 TRCN0000173557 GCTCAACAAGTTCCGGATCTA pLKO.1 1880 CDS 100% 4.950 6.930 N Mcmbp n/a
3 TRCN0000265145 ACAACCTATCAGACGACATAA pLKO_005 1927 CDS 100% 13.200 10.560 N Mcmbp n/a
4 TRCN0000265143 ACCAATGTAAACCGTAATTTA pLKO_005 3697 3UTR 100% 15.000 10.500 N Mcmbp n/a
5 TRCN0000265146 TTTCGTCTACAGATGACAATA pLKO_005 1491 CDS 100% 13.200 9.240 N Mcmbp n/a
6 TRCN0000216975 CAACCTATCAGACGACATAAC pLKO.1 1928 CDS 100% 10.800 7.560 N Mcmbp n/a
7 TRCN0000265144 GTAGGCACAAGAGGAGTTATG pLKO_005 724 CDS 100% 10.800 7.560 N Mcmbp n/a
8 TRCN0000265142 TGGACCTACAGCCCAGTAAAC pLKO_005 760 CDS 100% 10.800 7.560 N Mcmbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.