Transcript: Mouse NM_146007.2

Mus musculus collagen, type VI, alpha 2 (Col6a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Col6a2 (12834)
Length:
3729
CDS:
168..3272

Additional Resources:

NCBI RefSeq record:
NM_146007.2
NBCI Gene record:
Col6a2 (12834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091231 GCAGTTCGTACCGCAGTTTAT pLKO.1 425 CDS 100% 13.200 18.480 N Col6a2 n/a
2 TRCN0000091228 CGGTACACTTGGGTCTTTCTA pLKO.1 3348 3UTR 100% 5.625 7.875 N Col6a2 n/a
3 TRCN0000446991 TGCGCAACATGACGCTGTTCT pLKO_005 2560 CDS 100% 4.950 6.930 N COL6A2 n/a
4 TRCN0000116847 CGCATCATCAAGGTCATGAAA pLKO.1 909 CDS 100% 5.625 3.938 N COL6A2 n/a
5 TRCN0000091229 GCCACCTACCTCAATTCCTTT pLKO.1 2934 CDS 100% 4.950 3.465 N Col6a2 n/a
6 TRCN0000091230 GCTGGCAAGAATGGAACAGAT pLKO.1 1182 CDS 100% 4.950 3.465 N Col6a2 n/a
7 TRCN0000091232 GCACTCTATGCGTAAGCAGAA pLKO.1 3095 CDS 100% 4.050 2.835 N Col6a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.