Transcript: Mouse NM_146064.1

Mus musculus sterol O-acyltransferase 2 (Soat2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Soat2 (223920)
Length:
2126
CDS:
60..1637

Additional Resources:

NCBI RefSeq record:
NM_146064.1
NBCI Gene record:
Soat2 (223920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246787 TGCGGTGGTTCATGAGTATAT pLKO_005 1358 CDS 100% 13.200 18.480 N Soat2 n/a
2 TRCN0000216844 GTCACTGATCGATGAGCTAAT pLKO.1 380 CDS 100% 10.800 15.120 N Soat2 n/a
3 TRCN0000257709 GCTAATGGAGGTGCAACATTT pLKO_005 395 CDS 100% 13.200 10.560 N Soat2 n/a
4 TRCN0000246789 CCTCTTCTGCCCTACACTTAT pLKO_005 890 CDS 100% 13.200 9.240 N Soat2 n/a
5 TRCN0000246786 GCTTCTCCCAATGCAACAATA pLKO_005 1934 3UTR 100% 13.200 9.240 N Soat2 n/a
6 TRCN0000246788 GGTGCAATGGACTCGACATAT pLKO_005 170 CDS 100% 13.200 9.240 N Soat2 n/a
7 TRCN0000175668 GCAACATTTCCGAACCATCTA pLKO.1 407 CDS 100% 4.950 3.465 N Soat2 n/a
8 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2021 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.