Transcript: Mouse NM_146075.2

Mus musculus LEM domain containing 2 (Lemd2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lemd2 (224640)
Length:
2603
CDS:
21..1556

Additional Resources:

NCBI RefSeq record:
NM_146075.2
NBCI Gene record:
Lemd2 (224640)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202292 GCGCAGGAGTACATAGCTAAT pLKO.1 957 CDS 100% 10.800 15.120 N Lemd2 n/a
2 TRCN0000202490 GCTGCACGAACTGTACAACTT pLKO.1 860 CDS 100% 4.950 3.960 N Lemd2 n/a
3 TRCN0000278807 GCTGCACGAACTGTACAACTT pLKO_005 860 CDS 100% 4.950 3.960 N Lemd2 n/a
4 TRCN0000192997 GTATGAGATGGTGAAGAAGAT pLKO.1 1277 CDS 100% 4.950 3.465 N Lemd2 n/a
5 TRCN0000278757 GTATGAGATGGTGAAGAAGAT pLKO_005 1277 CDS 100% 4.950 3.465 N Lemd2 n/a
6 TRCN0000190063 GATGGACTAAGCCTTCCTCTT pLKO.1 1516 CDS 100% 4.050 2.835 N Lemd2 n/a
7 TRCN0000345572 GATGGACTAAGCCTTCCTCTT pLKO_005 1516 CDS 100% 4.050 2.835 N Lemd2 n/a
8 TRCN0000202247 GATGTGGTTCAGGACCACTAT pLKO.1 1302 CDS 100% 0.495 0.347 N Lemd2 n/a
9 TRCN0000278756 GATGTGGTTCAGGACCACTAT pLKO_005 1302 CDS 100% 0.495 0.347 N Lemd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146075.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.