Transcript: Mouse NM_146119.2

Mus musculus family with sequence similarity 129, member B (Fam129b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam129b (227737)
Length:
3693
CDS:
217..2466

Additional Resources:

NCBI RefSeq record:
NM_146119.2
NBCI Gene record:
Fam129b (227737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264735 CCCGTCACCTAATCCTGATAA pLKO_005 3267 3UTR 100% 13.200 18.480 N Fam129b n/a
2 TRCN0000264736 CCTTACGCCCGACACTATTAC pLKO_005 709 CDS 100% 13.200 18.480 N Fam129b n/a
3 TRCN0000283153 CTGTGTACCGCCTGGTATTTG pLKO_005 1037 CDS 100% 13.200 18.480 N Fam129b n/a
4 TRCN0000264734 ACTATGGGCTGGTGCTATATG pLKO_005 500 CDS 100% 13.200 10.560 N Fam129b n/a
5 TRCN0000173673 CGAGAAGATCCTCACAGAGTT pLKO.1 279 CDS 100% 4.950 3.465 N Fam129b n/a
6 TRCN0000193927 CGTGCTGAAGAAATACGACTA pLKO.1 1641 CDS 100% 4.050 2.835 N Fam129b n/a
7 TRCN0000173446 CCTGGATGAACGCATCATCTT pLKO.1 408 CDS 100% 0.495 0.347 N Fam129b n/a
8 TRCN0000264737 TGCTGAAGAAATACGACTATG pLKO_005 1643 CDS 100% 10.800 6.480 N Fam129b n/a
9 TRCN0000122833 GCAGAGCTGCTATGAGAAGAT pLKO.1 1422 CDS 100% 4.950 2.970 N NIBAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.