Transcript: Mouse NM_146142.2

Mus musculus tudor domain containing 7 (Tdrd7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tdrd7 (100121)
Length:
3656
CDS:
147..3407

Additional Resources:

NCBI RefSeq record:
NM_146142.2
NBCI Gene record:
Tdrd7 (100121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102518 CCTACGGAAGTCAATGATAAT pLKO.1 735 CDS 100% 13.200 18.480 N Tdrd7 n/a
2 TRCN0000435771 GCTCGTCAGAGGACCTCTAAA pLKO_005 408 CDS 100% 13.200 18.480 N Tdrd7 n/a
3 TRCN0000437406 GCAATTCGACATCCGTGAAAG pLKO_005 2329 CDS 100% 10.800 15.120 N Tdrd7 n/a
4 TRCN0000102519 CGAGTGGAGATCACTAATGTT pLKO.1 2268 CDS 100% 5.625 7.875 N Tdrd7 n/a
5 TRCN0000102516 CGGACTGTAGTATTAAGGTTA pLKO.1 2506 CDS 100% 4.950 6.930 N Tdrd7 n/a
6 TRCN0000102515 GCTTGAGATGTTGACCGCTAA pLKO.1 3413 3UTR 100% 4.050 5.670 N Tdrd7 n/a
7 TRCN0000102517 GCAGTCTCATAAGAACGGGAT pLKO.1 191 CDS 100% 2.160 3.024 N Tdrd7 n/a
8 TRCN0000414212 AGCATGAGCTCGTCAACATAA pLKO_005 3097 CDS 100% 13.200 9.240 N Tdrd7 n/a
9 TRCN0000414835 ATGTCAAAGTGACCAACATTT pLKO_005 2074 CDS 100% 13.200 9.240 N Tdrd7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.