Transcript: Mouse NM_146174.1

Mus musculus TRPM8 channel-associated factor 2 (Tcaf2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tcaf2 (232748)
Length:
4257
CDS:
177..2936

Additional Resources:

NCBI RefSeq record:
NM_146174.1
NBCI Gene record:
Tcaf2 (232748)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264667 GCGATAGATTGTAGATCTTAT pLKO_005 3393 3UTR 100% 13.200 18.480 N Tcaf2 n/a
2 TRCN0000264668 CAGATGTCTATGGAGATATAA pLKO_005 730 CDS 100% 15.000 10.500 N Tcaf2 n/a
3 TRCN0000264669 CTACGTGGCTCTGGGATAAAT pLKO_005 492 CDS 100% 15.000 10.500 N Tcaf2 n/a
4 TRCN0000148888 CCCAGTGAACTCCTTCTTATT pLKO.1 255 CDS 100% 13.200 9.240 N TCAF2 n/a
5 TRCN0000264666 GTCCCATTTGACCGATGATAT pLKO_005 1151 CDS 100% 13.200 9.240 N Tcaf2 n/a
6 TRCN0000283113 CCATTACCGTGGAGATCAATG pLKO_005 1762 CDS 100% 10.800 7.560 N Tcaf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146174.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.