Transcript: Mouse NM_146207.2

Mus musculus cullin 4A (Cul4a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cul4a (99375)
Length:
3628
CDS:
36..2315

Additional Resources:

NCBI RefSeq record:
NM_146207.2
NBCI Gene record:
Cul4a (99375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012783 CCCTGGCACTATATGGAGTTT pLKO.1 3073 3UTR 100% 4.950 3.960 N Cul4a n/a
2 TRCN0000012784 CGAGACAAAGACAGTCCAAAT pLKO.1 2274 CDS 100% 10.800 7.560 N Cul4a n/a
3 TRCN0000345059 CGAGACAAAGACAGTCCAAAT pLKO_005 2274 CDS 100% 10.800 7.560 N Cul4a n/a
4 TRCN0000012787 CCAGGTGTACAAAGACTCATT pLKO.1 707 CDS 100% 4.950 3.465 N Cul4a n/a
5 TRCN0000345058 CCAGGTGTACAAAGACTCATT pLKO_005 707 CDS 100% 4.950 3.465 N Cul4a n/a
6 TRCN0000012786 CCAGGATAGACAGTACCAGAT pLKO.1 2102 CDS 100% 4.050 2.835 N Cul4a n/a
7 TRCN0000353106 CCAGGATAGACAGTACCAGAT pLKO_005 2102 CDS 100% 4.050 2.835 N Cul4a n/a
8 TRCN0000012785 GCTTCGGAGTTTGCTAAGCAT pLKO.1 674 CDS 100% 3.000 2.100 N Cul4a n/a
9 TRCN0000345057 GCTTCGGAGTTTGCTAAGCAT pLKO_005 674 CDS 100% 3.000 2.100 N Cul4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.