Transcript: Mouse NM_146243.2

Mus musculus ARP2 actin-related protein 2 (Actr2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Actr2 (66713)
Length:
3688
CDS:
100..1284

Additional Resources:

NCBI RefSeq record:
NM_146243.2
NBCI Gene record:
Actr2 (66713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382142 ACTCACATTTGCCCAGTATAT pLKO_005 589 CDS 100% 13.200 9.240 N ACTR2 n/a
2 TRCN0000380936 CACCTGTGGGACTACACATTT pLKO_005 358 CDS 100% 13.200 9.240 N ACTR2 n/a
3 TRCN0000089994 CCTTACAAGGAGGCTGGATAT pLKO.1 630 CDS 100% 10.800 7.560 N Actr2 n/a
4 TRCN0000089995 CCTTCAACCATTCTGCTGATT pLKO.1 707 CDS 100% 4.950 3.465 N Actr2 n/a
5 TRCN0000089996 GCCTTCAACCATTCTGCTGAT pLKO.1 706 CDS 100% 4.050 2.835 N Actr2 n/a
6 TRCN0000113862 TGCCCAGTATATGAAGGCTTT pLKO.1 598 CDS 100% 4.050 2.835 N ACTR2 n/a
7 TRCN0000089993 GCCAGGTTTGAGTCCTTCAAA pLKO.1 3352 3UTR 100% 0.563 0.394 N Actr2 n/a
8 TRCN0000089997 AGGCTTTATTTCAGCCTCATT pLKO.1 887 CDS 100% 0.495 0.347 N Actr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.