Transcript: Mouse NM_146246.3

Mus musculus retinitis pigmentosa 1 homolog like 1 (Rp1l1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rp1l1 (271209)
Length:
6811
CDS:
220..5799

Additional Resources:

NCBI RefSeq record:
NM_146246.3
NBCI Gene record:
Rp1l1 (271209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267622 GGACCATGGTGTAAGCTTATG pLKO_005 3321 CDS 100% 10.800 15.120 N Rp1l1 n/a
2 TRCN0000254378 ATGCCAGGCAGGATCACTATT pLKO_005 2252 CDS 100% 13.200 9.240 N Rp1l1 n/a
3 TRCN0000254380 ATGTTGTCCCTGGGATCTAAA pLKO_005 6149 3UTR 100% 13.200 9.240 N Rp1l1 n/a
4 TRCN0000254381 CAGAGGAGGATCCCGAGATTT pLKO_005 5090 CDS 100% 13.200 9.240 N Rp1l1 n/a
5 TRCN0000254379 CACAACCCAGCTATGACATAT pLKO_005 1478 CDS 100% 13.200 7.920 N Rp1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146246.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.