Transcript: Mouse NM_146254.4

Mus musculus WD repeat domain 78 (Wdr78), mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Wdr78 (242584)
Length:
3793
CDS:
144..2567

Additional Resources:

NCBI RefSeq record:
NM_146254.4
NBCI Gene record:
Wdr78 (242584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146254.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115502 CGCTTGGATCAGATTATATTT pLKO.1 475 CDS 100% 15.000 21.000 N Wdr78 n/a
2 TRCN0000115503 GCGTATTTATCAGAGTTCATA pLKO.1 1610 CDS 100% 5.625 7.875 N Wdr78 n/a
3 TRCN0000115505 CGTATCAAGAACTATGGGTTT pLKO.1 290 CDS 100% 4.050 5.670 N Wdr78 n/a
4 TRCN0000115501 GCAGTCTACGAGCTGAGAAAT pLKO.1 2469 CDS 100% 13.200 10.560 N Wdr78 n/a
5 TRCN0000115504 GTTTGGCAAGTGCAGTGGATA pLKO.1 1782 CDS 100% 4.950 3.465 N Wdr78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146254.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.