Transcript: Mouse NM_146306.1

Mus musculus olfactory receptor 518 (Olfr518), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr518 (258303)
Length:
1002
CDS:
1..1002

Additional Resources:

NCBI RefSeq record:
NM_146306.1
NBCI Gene record:
Olfr518 (258303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204023 GTAGTCCTTACCAGCGAGAAA pLKO.1 304 CDS 100% 4.950 6.930 N Olfr518 n/a
2 TRCN0000185532 GTCTTACCCTATGATTATGAA pLKO.1 447 CDS 100% 5.625 3.938 N Olfr518 n/a
3 TRCN0000185009 CTGTTGATACTCTTGTCTTAT pLKO.1 691 CDS 100% 13.200 6.600 Y Olfr512 n/a
4 TRCN0000186699 GCAATGGCTTATGACCGATTT pLKO.1 406 CDS 100% 10.800 5.400 Y Olfr518 n/a
5 TRCN0000187560 GCAGACACCTTCCTGTTTGAA pLKO.1 625 CDS 100% 5.625 2.813 Y Olfr518 n/a
6 TRCN0000186690 GACCACAAGGAGATTAACCAT pLKO.1 565 CDS 100% 3.000 1.500 Y Olfr519 n/a
7 TRCN0000202737 CAAGGAGATTAACCATCTCTT pLKO.1 570 CDS 100% 0.495 0.248 Y Olfr519 n/a
8 TRCN0000194294 GCAATGGCTTATGACCGATAT pLKO.1 406 CDS 100% 10.800 5.400 Y Olfr1095 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.