Transcript: Mouse NM_146351.2

Mus musculus olfactory receptor 1133 (Olfr1133), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr1133 (258348)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_146351.2
NBCI Gene record:
Olfr1133 (258348)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203990 CACATCCTGTGCATTCAGATT pLKO.1 480 CDS 100% 4.950 3.465 N Olfr1133 n/a
2 TRCN0000185407 GAATTTGTCTTGTTAGGACTT pLKO.1 34 CDS 100% 4.050 2.430 N Olfr1133 n/a
3 TRCN0000188843 GCATTGTCACAGTCCTTCTCT pLKO.1 632 CDS 100% 3.000 1.800 N Olfr1133 n/a
4 TRCN0000204433 CCTGTGCATTCAGATTGTCCT pLKO.1 485 CDS 100% 2.640 1.584 N Olfr1133 n/a
5 TRCN0000185284 GAGAAGAGGATTCCTTATAAT pLKO.1 268 CDS 100% 15.000 7.500 Y Olfr1133 n/a
6 TRCN0000185310 GCATTGTTCTTCCTTGTTTAT pLKO.1 88 CDS 100% 13.200 6.600 Y Olfr1134 n/a
7 TRCN0000188322 CCTTCTCTCCTACTGCTACAT pLKO.1 645 CDS 100% 4.950 2.475 Y Olfr1128 n/a
8 TRCN0000203572 GCATTGTCACAGTCCTTCTAT pLKO.1 632 CDS 100% 5.625 3.375 N Olfr1134 n/a
9 TRCN0000204235 CTAGGGATGATCCTGCTGATT pLKO.1 130 CDS 100% 4.950 2.475 Y Olfr1446 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.